Thursday, May 18, 2006

GATCAATGAGGTGGACACCAGAG

I had a cool post saved for this week but I just came across this which happened today.....

After 10 years the last of the Human Genome has been mapped. Whether future celebrates or rues this day only our kids will know, but it is a pretty big deal.



Reuters News Release

The Human Genome Project has published the sequence online in the journal Nature. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique.



Also reported... a competing study from The University of Hobart... to see if the can build it out of lego.


The University of Hobart's funding was cut short a small way into the project only producing this small result.


I have already splashed out and bought a kit to use in conjunction with this new information, in the hope of curing some of matts obvious deformities.



Dad joke


Three Indian women are sitting side by side. The first, sitting on a goatskin, has a son who weighs 170 pounds. The second, sitting on a deerskin, has a son who weighs 130 pounds. The third, seated on a hippopotamus hide, weighs 300 pounds. What famous theorum does this illustrate?

Naturally, the answer is that the squaw on the hippopotamus is equal to the sons of the squaws on the other two hides.

2 comments:

Margs said...

do you get these from a Dad joke website? or are you really just that dad-ish?

john said...

This one was the result of a google search for 'cheesy joke'