When florist get bored

This is what happens when florist have too much time on their hands. They are quite cute though. I thought maybe either marg's, sarah or corrinne might like them for a wedding bouquet.

Opps! A slip of the tongue

Since it is the beginnning of exam week, i dont have much to report on for this week except for......
It was the end of a very long day and i was with my home room class, checking the roll, making sure girls had put their chairs on their desks and had their blazers and berets on before leaving school. Then i notice a pile of rubbish at the back of the classroom. I said in a loud voice: "year eight, make sure this room is neat and tidy before you leave, and can some one remove all that crap at the back there." it was a slip of the tongue.....but the response from the girls was priceless. they were so suprised, lots giggled we all had a bit of a laugh and i was red with embarassment.

Shoesday- high (heel) profile

Throughout the history of the world countless people have lived and died who left not a scrap for their later recognition. There have also been thousands who made their mark and preserved their identity for centuries to come through great careers in science, politics, philosophy, art and war craft. Now and then, one comes along who try as they might, will not be remembered for their career ambitions and achievements and Catherine de’ Medici was one such woman.

Catherine was born in Florence in 1519 to an Italian Duke and French princess, both dying and leaving Catherine to grow up in a convent. At 15 she married Henry, Duke of Orleans and moved to France where she would later become Queen, regent and Queen Mother of France. While her career was colourful and stained with the blood of many of her contemporaries, it was her refined taste that would change the world forever.

Among her credits is the refinement of French cooking with her Florentine chefs working their magic on the already developing local cuisine. Dessert was one of her gifts to medieval Europe and to the western-world menus descended from there. If not for Catherine, we would not know the pleasure of sweet separated from savoury!

Also inspired by her many soirees, she combined the talents of local French performers and artists from her home land and commissioned the invention of ballet to entertain her many guests.

Catherine was reportedly somewhat plain and she found it difficult dealing with the humiliation of her husband openly keeping a mistress. Appearance became a mild obsession with her and the effects are still with us today.

Catherine banned thick waists at court, popularizing corsets and the distorted body shapes they created. Corsets remained vital to ladies fashion for the next 350 years and dangerously thin waists have been totally ‘in’ ever since.

We have Catherine to thank for the corner stone of modern everyday style- lip gloss! Catherine just blended a little beeswax with food colouring to produce a reddish coloured lip salve that could keep her moisturized and looking good for hours.

Most importantly though, Catherine was lacking in the height department and in 1532, when facing the splendid French court for the first time she got her favourite Florentine cobbler to remove the clunky wooden soles from her shoes and replace it with slender padded four-inch heels. Voila! 1533 here we come… hot.

And where would we be without slinky high heels today? (That was rhetorical. I shall not be held responsible for any fainting fits or bouts of severe depression that are brought on by readers trying to imagine a world without oh-so-vital high heels.)

G'arn the Dogs!

So on a suitably cold and wintery night we rugged up and headed to the track!

It was great! we bet on the dogs, we drank our fill of booze, we mixed it with the best of the west! While some of us broke even or (heaven forbid) came out down a bit, others were more successful....

The big winners of the night were Flit and Alex. While Flit studied the guide and drew comparisons to choose his bets, Alex went by the more traditional method of choosing his favourite name...works a charm when your girlfriend is Jenny and the dog named 'Dana Jenny' comes in 1st!

Here we see Mattes trying to work out that pesky form...

Afterwards there was much merry making and singing. We converged on the good ole faithful Friend in Hand (actually, not so faithful but still good) and took over the dukebox for an 80's feast. With Gaby and Evil at the wheel and a bunch of drunks slurring past favourites at them we were in for a treat...as was the rest of the bar. Funnily enough there were no complaints, instead we actually got everyone singing 'Eternal Flame' together....ah memories!

Unfortunately, the photos I took of Alex, burning up the floor to....NELLY!! were too blurred for posting. Suffice to say, we laughed and laughed and laughed at his apparent passion for the pop god! Who'd have thunk it?

That's the doggies for this year, perhaps our trip down there next year will be in the warmer months and I might even remember to take a photo of a REAL dog...

I will X-ray your teeth.

It will all be explained here I particularly chuckled at the last Dutch entry.

School Pranksters

With school exams close at hand, the tension and stress of the girls is starting to show, which leads them to do strange and wonderful things.
Today i was teaching year eight and things were going well when a couple of girls (from yr9) came in pretending to be late for the lesson, apologising, and they wanted to take a seat in the laboratory. They knew it was the wrong class, and i got them to leave right away. Crazy girls, trying to pull a stunt like that! I thought it was pretty funny and had to stop my self from laughing.

Wonderful World of Google.

Google as rolled out another in it's long line of products - Google Trends. Ok it's not the most useful tool out there but is sure generates some interesting Trivia, as SMH yesterday pointed out

http://www.google.com/trends

Sheep - NZ Number one (Aust number two)
Porn - NZ Number two (Aust number three)

Sex - Mainly Muslim countries.
matt starr - USA then Canada
google - India, UK (Who googles google from google idiots)
stephen roberts - UK, Australia
lonely - Ireland


And while I'm in google....
The Real hits:
Shari Seccombe
Jenny Waern
Julian Flitcroft - Second Place, nice work.

Not quite sure:
Gabby Hold - The Glass Ceiling

The hidden lives:
John Allinson - Artist
Margaret Instance - Contributor to the Generation Game.
Mathew Starr - Check out his 'friends'.
Sarah Franklin
Bronwen Williams - Get her CD now (and a signed photo)
The many lives of Good Nick: Speedster, Comic Genious Wow google loves nick.
Richard Andrew - The Richard Andrew Experiment, I think we all know that has failed ;)
Evil - Sorry the is to many Nick hold me, nick hold on's for me to trawl through.
Matt Nicholson
Dj Bryan

No Results... Create a web page so google can love you too.
Bronwyn Sammut

Dad Joke

---------- SUBMISSIONS SORELY NEEDED ---------------------
Ida Mae passed away and Nick called 000. The 000-operator told Nick that she would send someone out right away.

'Where do you live?' asked the operator.

Nick replied, 'At the end of Eucalyptus Drive.'

The operator asked, 'Can you spell that for me?'

After a long pause, Nick said, 'How 'bout I drag her over to Oak Street and you pick her up there?'

Shoesday - By Proxy

Since the lovely usual author of this column is down in Melbourne to learn about all things HR, she has passed the honour to me. Let's hope I live up to the challenge.

There are some brilliant people out there. It would appear that there is something in this world that's almost as good as beautiful new shoes. And that's beautiful new chocolate shoes. Why do I have to discover these things when I'm on a diet? These fabulous one-of-a-kind chocolate stilettos are $34 each from Gayle's Chocolates. And as a note to all my friends, family and especially fiancee I know Christmas is still ages away, but these would make the perfect bribe, I mean gift...


It is amazing how many other people have thought of the same glorious idea...



Here's an interesting idea for those men out there who have a partner with a shoe addiction....

Imagine how many more shoes you could store!!

Or perhaps to mark the occasion of the Green/Mundine fight...


and to top it all off, Flit and I could combine our passions...


So while this has been a somewhat random Shoesday, Lady will be back next week to enlighten you all further on the wonderful world of shoes!

Back in the club!

It is no longer illegal for me to drive a car in the Commonwealth of Australia. Hurrah!

Sun and Bowling!

Although G'Nick's birthday was weeks ago, he felt it necessary to extend the festivities to this weekend for some lawn bowls in the glorious autumnal sun!

People came from near and far to book lanes, buy beer and ...bowl bowls(?)

The games were intensly watched...


and action packed....


We took up three lanes. Our lane had two teams...Talls vs Shorts, with a triumphant talls team taking out the trophy....An honourable mention to Gaby from the shorts, who, after having to be reminded it was her go for the whole game, eventually managed to be ready for her go on the second last bowl. I think we must also mention the fabulous effort from two of our girls, Bron and Shari, who suprised all with their accuracy and skill...have you guys got any white uniforms stashed away??

Meanwhile, G'Nicks lane decided that bowling to get the closest to the jack was for suckers, so they went for the gutter along the back instead!

...at least he's pretty.

Between games, Mattes gave us an exclusive preview of his new look...

...complete with beer foam in his tash...very attractive!

We were blessed with sun and warmth, we broke some glasses, we had lots of laughs....a good day all round really!

My fabulous new furniture!!!

Thankyou to all the boys and girls who helped with the making of my lovely new set of shelves!

John and Matt spent the majority of saturday hard at work in the backyard of chicken, with numerous powertools and merk pacers/writing pads...
When taking breaks from being the resident poindexter, matten also chipped in...
And Greta played the role of tea lady...

And by nightfall I had this wonderfull assembly installed...
And these generous boys have offered to come back next weekend to stain it! Thankyou boys!

Explosion in Bronny's Science Lab

Today, i was teaching the Year 8's and it was time to demonstrate sodium reacting with water (again, for the second class). I was feeling confident after wednesday's extravaganva, so i was expecting it all to run smoothly.

The girls had their goggles on, the lights were dimmed. i struggled to get a peice of sodium out of the jar, and the girls were waiting in anticipation. eventually i managed to take out a piece of sodium, i cut a 'small' piece off and put it in the water.
it wizzed around, then caught alit, then it all went terribly wrong. the sodium started to splatter up and out of the large beaker, landing on my and the girls bench. it was like a small fireworks display, small fireballs flying into the air. some even melted the side of the sink. there was a small amount of smoke, and i asked the girls to exit out the back door. after a few minutes, the girls were asked to come back inside and explained how that was not supposed to happen. the girls were absolutely thrilled, asking 'can you do that again'......'no way' i said. some even said that they will never forget that....... so i have left my mark on the girls and also on the sink in the science lab.

the moral of the story is: miss bron should be a bit more careful when trying to make science fun, using sodium.

It's Friday and I'm bored post

Well I hope you are all working away busily. This week I have a review of what is claimed to be the worst theme park in the world.

However if you find that a little tame and boring there is something a little more risque on offer. Warning!! The following scenes may offend some viewers - but what do you expect from a toy called the Oozinator.

On behalf of the Sydney SRF....

I'm sure my fellow Sydney SRF members will not be upset if I take the opportunity to thank our far flung cousin for her kind thoughts.

Last night at Trivia, an unexpected card arrived, addressed, sure enough to the SRF Thursday night, trivia team! Imagine our suprise that it got to us all the way from France!!

Thank you for thinking of us on your little journey, it brought happy smiles all round!

You funny funny girl....very sweet.

GATCAATGAGGTGGACACCAGAG

I had a cool post saved for this week but I just came across this which happened today.....

After 10 years the last of the Human Genome has been mapped. Whether future celebrates or rues this day only our kids will know, but it is a pretty big deal.



Reuters News Release

The Human Genome Project has published the sequence online in the journal Nature. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique.

Also reported... a competing study from The University of Hobart... to see if the can build it out of lego.

The University of Hobart's funding was cut short a small way into the project only producing this small result.

I have already splashed out and bought a kit to use in conjunction with this new information, in the hope of curing some of matts obvious deformities.

Dad joke

Three Indian women are sitting side by side. The first, sitting on a goatskin, has a son who weighs 170 pounds. The second, sitting on a deerskin, has a son who weighs 130 pounds. The third, seated on a hippopotamus hide, weighs 300 pounds. What famous theorum does this illustrate?

Naturally, the answer is that the squaw on the hippopotamus is equal to the sons of the squaws on the other two hides.

Excitement in the Science Lab

Yesterday was the beginning of a new science topic for year 8. After boring units such as astronomy and rocks, it was promised that chemistry would be filled with experiments, excitement and fun.

To start it off with a bang (or was that a pop) we made some hydrogen gas and tested for its presence with the 'pop' test....the lab was filled with screams, shreiks and laughter. It was quite funny for me, just waiting in anticipation for the girls to hear the 'pop'.

Then it was time to observe another element from the periodic table. SODIUM. it was my first time using the metal, so i was a bit nervous, but to enhance the dangerous nature of sodium, or for dramatic effect, all girls in the front row had to wear their goggles and sit back.....safety of course. I explained to the girls that if sodium comes in contact with air or water it becomes very dangerous. So i cut off a chunk and put it into a large beaker of water, it wizzed around in the water than ignited....ohhhh, argh, wow !!! the girls were definitely impressed.

Today i have the other year 8 class for the same lesson.... hope it goes just as well.

For your weekly up-date of science thrills and spills in Bronny's science lab, watch this space.

Shoesday- Boots of burden

Last week, while the gritty reality of shoes gone bad was too much for the delicate constitution of the gentle Lady, Matten was quick to register his reluctance to visit the world of shoe loveliness quite so soon. In an attempt to please as much of the House of Chicken as possible, let us leave the world of people shoes this week and take a look at the latest fashion in horse shoes.

You’ll all be familiar with this sturdy staple:
A true classic and one of those basic pieces that form the foundation for any horse’s wardrobe, the standard ‘u’ (or ‘n’ to our northern hemisphere associates) has proved its worth over the centuries and shall remain a stalwart of equine footwear for centuries to come.

This season, with the endorsement of the OC's Mischa Barton, the sandshoe is IN. In a range of cute colours, fillies in the know will be sporting these little numbers:

For the more adventurous types, the ruggered outdoor look can be best achieved with a pair of hiking boots in colorado tan or basic black:

And what about the playful type? Mares can get going in a pair of cowboy boots, complete with ironic spurrs, great for casual or dresed up with a cute tail ribbon:

For ponies who are into the urban look made popular by the rising hip hop phenomenon, Nike has taken care of their sneakers:

Feminine fillies will feel like princesses in these dressy little pumps: There's a stylish and functional horseshoe for every occasion, for beasts of burden on the go. To check out more hot designs see the guide horse website for this season's latest. Your second best friend can be well shod for winter.

Wollombi

This weekend Shari and I went up to Wollombi to my parents new holiday house. Wollombi, is 2hrs from the CBD and half an hour from Cessnock and very pretty.

Walkabout Review       SMH Review

Why should you care: Mum and dad bought it for everyone in the family to Holiday too, so some time soon I thought we should go up and have a weekend away.



It's two bedrooms, one bathroom but the living room is huge and there's lots of room for camping. It has water, power and gas but from tanks and solar.


The local town is also fantastic, with a great pubs cafes and a catholic church and an anglican one (for thoses that way inclined)

SRF Event- The dogs

What: The Doggies

When: 7:30pm, Saturday 27th May

Where: Wentworth Park, Glebe

Why: Get in touch with your bogan side- beer, a flutter and a chance to model your latest flanno and beanie

Only In New Zealand...

FLATULENCE SETS HOSPITAL ON FIRE

A PATIENT'S flatulence has been blamed for bringing his hemorrhoid operation to a fiery end. The man suffered minor burns in a brief but dramatic operating theatre fire.
The patient was at the Southern Cross Hospital in Invercargill, New Zealand, to have hemorrhoids removed when the accident happened.
A hospital source said there was a sort of flash fire. The hospital confirmed a fire did occur, and has ordered an investigation.

The Sydney Morning Herald, May 14 2006.

The Case of the Mystery Beauty Treatments

....And so the saga continues!

BACKGROUND: Mid week phone call informed me of my facial appointment and asked me to confirm. I phoned back to tell them they made a mistake....never had a facial, never booked a facial. They phoned back to say someone has paid for it and put it in my name with my contact details, so come in and enjoy!

Today was d-day. Gorgeous little salon in the heart of Neutral Bay...2.30pm.
One hour of sheer LUXURY!!! Dim lights, soothing music, sweet smelling oils, potions, creams and mud...GLORIOUS MUD! Throw a head, neck and shoulders massage in and I'm falling asleep....."floating aloft on creams and scented lotions"...

As the whole decadent session came to an end and I crawled back from the edge of a lovely soft nap...I vowed to SO do it again!! (especially if someone else is paying)

Here's one to start

http://asecular.com/~scott/misc/toilet.htm

I did nearly wet myself reading this.

Call to Arms.

Ok I think we need a "I'm bored on Friday afternoon and here's some entertainment / something to wake me" correspondent. Anyone want a permanent weekly spot? Please?


On a side note I got this lovely response from someone today, so I thought I'd share it with you.

Walking the Digital Red Carpet.

While everyone was focusing on the logie's this week, the webbies went but without a word of note, so I thought I'd rectify that in this weeks nerdy post.

The Webbies....

The Webby Awards is the leading international award honoring excellence in Web design, functionality and creativity. Established in 1996 during the web's infancy, the Webbys are presented by The International Academy of Digital Arts and Sciences, a 500-member body of leading web experts, business figures, luminaries, visionaries and creative celebrities.

This year we had the following winners...

	WEBBY ARTIST OF THE YEAR
		Gorillaz
		http://www.gorillaz.com/
	BREAKOUT OF THE YEAR
		MySpace.com
		http://www.myspace.com
	WEBBY ENTREPRENEUR OF THE YEAR
		Marc Cuban
		http://www.blogmaverick.com/
	WEBBY LIFETIME ACHIEVEMENT
		Dr. Robert Kahn
		http://www.cnri.reston.va.us/bios/kahn.html
	WEBBY PERSON OF THE YEAR
		Thomas Friedman
		http://www.thomaslfriedman.com/

There are lots more here -> http://www.webbyawards.com/webbys/current.php?season=10

My Favourite - this is pretty smooth and funky -> http://www.bebopjeans.com/

Oh and the bit you really care about

The Dad Joke

Running Doe, a young Native American woman went to a doctor for her first ever physical exam. After checking all of her vitals and running the usual tests, the doctor said, "Well, Running Doe, you are in fine health. I could
find no problems. I did notice one abnormality however."

"Oh, what is that, Doctor?"

"Well, you have no nipples."

"None of the people in my tribe have nipples," she replied.

"That is amazing," said the doctor. "I'd like to write this up for Journal of Medicine if you don't mind."

She said, "OK."

"First of all" asked the doctor, "how many people are in your tribe?''

She answered, "Approximately 500."

"And what is the name of your tribe?" asked the doctor.

Running Doe replied, "We're called "...The Indiannippeless Five Hundred."